Hevert-Arzneimittel Agarose,Blocking,Epiquik ILC3, eine zentrale angeborene Immunkomponente

ILC3, eine zentrale angeborene Immunkomponente


hvr-ev

ILC3, eine zentrale angeborene Immunkomponente der Darm-Gehirn-Achse bei Multipler Sklerose 

Intestine immune cells have been more and more appreciated as vital gamers within the central nervous system (CNS) autoimmunity in animal fashions of a number of sclerosis (MS). Among the many intestine immune cells, innate lymphoid cell kind 3 (ILC3) is of particular curiosity in MS analysis, as they symbolize the innate cell counterpart of the foremost pathogenic cell inhabitants in MS, i.e. T helper (Th)17 cells.

Importantly, these cells have been proven to stimulate regulatory T cells (Treg) and to counteract pathogenic Th17 cells in animal fashions of autoimmune illnesses. In addition to, they’re additionally well-known for his or her means to stabilize the intestinal barrier and to form the immune response to the intestine microbiota. Thus, correct upkeep of the intestinal barrier and the institution of the regulatory milieu within the intestine carried out by ILC3 could forestall activation of CNS antigen-specific Th17 cells by the molecular mimicry. Latest findings on the function of ILC3 within the gut-CNS axis and their relevance for MS pathogenesis will probably be mentioned on this paper. Prospects of ILC3 useful modulation for the advantage of MS sufferers will probably be addressed, as effectively.

hvr-ev

hvr-ev

anti- AIRE antibody

FNab00241 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-200
  • Immunogen: autoimmune regulator
  • Uniprot ID: O43918
  • Gene ID: 326
  • Research Area: Metabolism
Description: Antibody raised against AIRE

Anti-AIRE antibody

PAab00241 100 ug
EUR 355

Anti-AIRE Antibody

PB9980 100ug/vial
EUR 334

Anti-AIRE antibody

STJ116116 100 µl
EUR 277
Description: This gene encodes a transcriptional regulator that forms nuclear bodies and interacts with the transcriptional coactivator CREB binding protein. The encoded protein plays an important role in immunity by regulating the expression of autoantigens and negative selection of autoreactive T-cells in the thymus. Mutations in this gene cause the rare autosomal-recessive systemic autoimmune disease termed autoimmune polyendocrinopathy with candidiasis and ectodermal dystrophy (APECED).

Anti-AIRE antibody

STJ22559 100 µl
EUR 277
Description: This gene encodes a transcriptional regulator that forms nuclear bodies and interacts with the transcriptional coactivator CREB binding protein. The encoded protein plays an important role in immunity by regulating the expression of autoantigens and negative selection of autoreactive T-cells in the thymus. Mutations in this gene cause the rare autosomal-recessive systemic autoimmune disease termed autoimmune polyendocrinopathy with candidiasis and ectodermal dystrophy (APECED).

Anti-AIRE antibody

STJ70934 100 µg
EUR 359

Anti-AIRE antibody

STJ71077 100 µg
EUR 359

Anti-AIRE antibody

STJ70203 100 µg
EUR 359

Human Autoimmune Regulator (AIRE) ELISA Kit

DLR-AIRE-Hu-48T 48T
EUR 517
  • Should the Human Autoimmune Regulator (AIRE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Autoimmune Regulator (AIRE) in samples from tissue homogenates or other biological fluids.

Human Autoimmune Regulator (AIRE) ELISA Kit

DLR-AIRE-Hu-96T 96T
EUR 673
  • Should the Human Autoimmune Regulator (AIRE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Autoimmune Regulator (AIRE) in samples from tissue homogenates or other biological fluids.

Mouse Autoimmune Regulator (AIRE) ELISA Kit

DLR-AIRE-Mu-48T 48T
EUR 527
  • Should the Mouse Autoimmune Regulator (AIRE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Autoimmune Regulator (AIRE) in samples from tissue homogenates or other biological fluids.

Mouse Autoimmune Regulator (AIRE) ELISA Kit

DLR-AIRE-Mu-96T 96T
EUR 688
  • Should the Mouse Autoimmune Regulator (AIRE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Autoimmune Regulator (AIRE) in samples from tissue homogenates or other biological fluids.

Human Autoimmune Regulator (AIRE) ELISA Kit

RD-AIRE-Hu-48Tests 48 Tests
EUR 521

Human Autoimmune Regulator (AIRE) ELISA Kit

RD-AIRE-Hu-96Tests 96 Tests
EUR 723

Mouse Autoimmune Regulator (AIRE) ELISA Kit

RD-AIRE-Mu-48Tests 48 Tests
EUR 533

Mouse Autoimmune Regulator (AIRE) ELISA Kit

RD-AIRE-Mu-96Tests 96 Tests
EUR 740

Human Autoimmune Regulator (AIRE) ELISA Kit

RDR-AIRE-Hu-48Tests 48 Tests
EUR 544

Human Autoimmune Regulator (AIRE) ELISA Kit

RDR-AIRE-Hu-96Tests 96 Tests
EUR 756

Mouse Autoimmune Regulator (AIRE) ELISA Kit

RDR-AIRE-Mu-48Tests 48 Tests
EUR 557

Mouse Autoimmune Regulator (AIRE) ELISA Kit

RDR-AIRE-Mu-96Tests 96 Tests
EUR 774

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Anti-AIRE-1 antibody

STJ91518 200 µl
EUR 197
Description: Rabbit polyclonal to AIRE-1.

Anti-AIRE-1 antibody

STJ91519 200 µl
EUR 197
Description: Rabbit polyclonal to AIRE-1.

AIRE Antibody

33590-100ul 100ul
EUR 252

AIRE Antibody

33590-50ul 50ul
EUR 187

AIRE Antibody

32424-100ul 100ul
EUR 252

AIRE Antibody

1-CSB-PA000839
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against AIRE. Recognizes AIRE from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/10000

AIRE Antibody

1-CSB-PA001502HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AIRE. Recognizes AIRE from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

AIRE Antibody

CSB-PA001502KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against AIRE. Recognizes AIRE from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

AIRE Antibody

CSB-PA001502KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against AIRE. Recognizes AIRE from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

AIRE Antibody

DF3026 200ul
EUR 304
Description: AIRE Antibody detects endogenous levels of total AIRE.

AIRE Antibody

DF6603 200ul
EUR 304
Description: AIRE Antibody detects endogenous levels of total AIRE.

AIRE Antibody

CSB-PA274868-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against AIRE. Recognizes AIRE from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

AIRE Antibody

CSB-PA274868-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against AIRE. Recognizes AIRE from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

AIRE antibody

70R-34455 100 ug
EUR 327
Description: Rabbit polyclonal AIRE antibody

AIRE antibody

70R-51449 100 ul
EUR 244
Description: Purified Polyclonal AIRE antibody

AIRE antibody

70R-33714 100 ug
EUR 327
Description: Rabbit polyclonal AIRE antibody

AIRE Antibody

AF0334 200ul
EUR 304
Description: AIRE antibody detects endogenous levels of total AIRE.

AIRE Antibody

1-CSB-PA009261
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against AIRE. Recognizes AIRE from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

AIRE Antibody

ABF5471 100 ug
EUR 438

AIRE Antibody

ABD3026 100 ug
EUR 438

AIRE Antibody

ABD6603 100 ug
EUR 438

AIRE Antibody

ABF0334 100 ug
EUR 438

Anti-Phospho-AIRE-1 (S156) antibody

STJ90618 200 µl
EUR 197
Description: Rabbit polyclonal to Phospho-AIRE-1 (S156).

Polyclonal AIRE Antibody

APR03336G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AIRE . This antibody is tested and proven to work in the following applications:

AIRE antibody (Ser156)

70R-34454 100 ug
EUR 327
Description: Rabbit polyclonal AIRE antibody (Ser156)

AIRE Conjugated Antibody

C32424 100ul
EUR 397

AIRE (pS156) Antibody

abx332932-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

Polyclonal Goat Anti-AIRE (isoform 1) Antibody

APG00016G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-AIRE (isoform 1) . This antibody is tested and proven to work in the following applications:

AIRE siRNA

20-abx907108
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AIRE siRNA

20-abx907109
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Autoimmune regulator (AIRE) Antibody

48129-100ul 100ul
EUR 333

Autoimmune regulator (AIRE) Antibody

48129-50ul 50ul
EUR 239

Autoimmune regulator (AIRE) Antibody

48149-100ul 100ul
EUR 333

Autoimmune regulator (AIRE) Antibody

48149-50ul 50ul
EUR 239

AIRE (Phospho-Ser156) Antibody

11782-100ul 100ul
EUR 252

AIRE (Phospho-Ser156) Antibody

11782-50ul 50ul
EUR 187

AIRE-1 Polyclonal Antibody

40562-100ul 100ul
EUR 252

AIRE-1 Polyclonal Antibody

40562-50ul 50ul
EUR 187

AIRE Antibody, HRP conjugated

1-CSB-PA001502HB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AIRE. Recognizes AIRE from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

AIRE Antibody, FITC conjugated

1-CSB-PA001502HC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AIRE. Recognizes AIRE from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

AIRE Antibody, Biotin conjugated

1-CSB-PA001502HD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AIRE. Recognizes AIRE from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-AIRE (Ser156) Antibody

CSB-PA217298-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-AIRE (Ser156). Recognizes Phospho-AIRE (Ser156) from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-AIRE (Ser156) Antibody

CSB-PA217298-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-AIRE (Ser156). Recognizes Phospho-AIRE (Ser156) from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Autoimmune Regulator (AIRE) Antibody

20-abx007582
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Autoimmune Regulator (AIRE) Antibody

abx019018-100ug 100 ug
EUR 342
  • Shipped within 5-10 working days.

Autoimmune Regulator (AIRE) Antibody

20-abx175527
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Autoimmune Regulator (AIRE) Antibody

20-abx175528
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Autoimmune Regulator (AIRE) Antibody

20-abx175529
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Autoimmune Regulator (AIRE) Antibody

abx117155-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Autoimmune Regulator (AIRE) Antibody

abx038141-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Autoimmune Regulator (AIRE) Antibody

20-abx171376
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Autoimmune Regulator (AIRE) Antibody

20-abx013298
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Polyclonal AIRE Antibody (Internal)

APG00998G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human AIRE (Internal). This antibody is tested and proven to work in the following applications:

Phospho-AIRE (S156) Antibody

1-CSB-PA009259
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-AIRE (S156). Recognizes Phospho-AIRE (S156) from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

Autoimmune Regulator (AIRE) Antibody

abx331461-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Autoimmune Regulator (AIRE) Antibody

20-abx325675
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Autoimmune Regulator (AIRE) Antibody

20-abx323992
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

AIRE (Isoform 1) Antibody

abx432298-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Autoimmune Regulator (AIRE) Antibody

20-abx312575
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Autoimmune Regulator (AIRE) Antibody

abx230241-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

AIRE-1 Polyclonal Antibody

ABP50619-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human AIRE-1 at AA range: 60-140
  • Applications tips:
Description: A polyclonal antibody for detection of AIRE-1 from Human, Mouse. This AIRE-1 antibody is for WB , IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human AIRE-1 at AA range: 60-140

AIRE-1 Polyclonal Antibody

ABP50619-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human AIRE-1 at AA range: 60-140
  • Applications tips:
Description: A polyclonal antibody for detection of AIRE-1 from Human, Mouse. This AIRE-1 antibody is for WB , IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human AIRE-1 at AA range: 60-140

AIRE-1 Polyclonal Antibody

ABP50619-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human AIRE-1 at AA range: 60-140
  • Applications tips:
Description: A polyclonal antibody for detection of AIRE-1 from Human, Mouse. This AIRE-1 antibody is for WB , IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human AIRE-1 at AA range: 60-140

AIRE-1 Polyclonal Antibody

ABP54773-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human AIRE-1 around the non-phosphorylation site of S156
  • Applications tips:
Description: A polyclonal antibody for detection of AIRE-1 from Human. This AIRE-1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human AIRE-1 around the non-phosphorylation site of S156

AIRE-1 Polyclonal Antibody

ABP54773-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human AIRE-1 around the non-phosphorylation site of S156
  • Applications tips:
Description: A polyclonal antibody for detection of AIRE-1 from Human. This AIRE-1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human AIRE-1 around the non-phosphorylation site of S156

AIRE-1 Polyclonal Antibody

ABP54773-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human AIRE-1 around the non-phosphorylation site of S156
  • Applications tips:
Description: A polyclonal antibody for detection of AIRE-1 from Human. This AIRE-1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human AIRE-1 around the non-phosphorylation site of S156

Autoimmune Regulator (AIRE) Antibody

20-abx001466
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

AIRE-1 Polyclonal Antibody

ES1618-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against AIRE-1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

AIRE-1 Polyclonal Antibody

ES1618-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against AIRE-1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

AIRE-1 Polyclonal Antibody

ES5772-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against AIRE-1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

AIRE-1 Polyclonal Antibody

ES5772-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against AIRE-1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Polyclonal Goat Anti-AIRE (isoforms 1 + 2) Antibody

APG00017G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-AIRE (isoforms 1 + 2) . This antibody is tested and proven to work in the following applications:

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

Polyclonal Goat Anti-AIRE (isoforms 1 and 2) Antibody

APG00018G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-AIRE (isoforms 1 and 2) . This antibody is tested and proven to work in the following applications:

AIRE Rabbit pAb

A14183-100ul 100 ul
EUR 308

AIRE Rabbit pAb

A14183-200ul 200 ul
EUR 459

AIRE Rabbit pAb

A14183-20ul 20 ul
EUR 183

AIRE Rabbit pAb

A14183-50ul 50 ul
EUR 223

AIRE Blocking Peptide

DF3026-BP 1mg
EUR 195

AIRE Blocking Peptide

DF6603-BP 1mg
EUR 195

AIRE Blocking Peptide

20-abx062024
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

AIRE Blocking Peptide

AF0334-BP 1mg
EUR 195

AIRE Rabbit pAb

A1767-100ul 100 ul
EUR 308

AIRE Rabbit pAb

A1767-200ul 200 ul
EUR 459

AIRE Rabbit pAb

A1767-20ul 20 ul
EUR 183

AIRE Rabbit pAb

A1767-50ul 50 ul
EUR 223

AIRE (isoform 1)

GT41000 100 ug
EUR 474

Autoimmune regulator (AIRE) Conjugated Antibody

C48129 100ul
EUR 397

Polyclonal AIRE Antibody (C-Terminus)

APG00997G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human AIRE (C-Terminus). This antibody is tested and proven to work in the following applications:

AIRE-1 Polyclonal Conjugated Antibody

C40562 100ul
EUR 397

AIRE (Isoforms 1 + 2) Antibody

abx431084-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Autoimmune Regulator (AIRE) Antibody (HRP)

20-abx312576
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Autoimmune Regulator (AIRE) Antibody (FITC)

20-abx312577
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Autoimmune Regulator (AIRE) Antibody (Biotin)

20-abx312578
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

AIRE (Phospho-Ser156) Polyclonal Conjugated Antibody

C11782 100ul
EUR 397

AIRE (Isoforms 1 and 2) Antibody

abx432299-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

AIRE-1 (phospho Ser156) Polyclonal Antibody

ABP54772-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human AIRE-1 around the phosphorylation site of S156
  • Applications tips:
Description: A polyclonal antibody for detection of AIRE-1 phospho Ser156) from Human. This AIRE-1 phospho Ser156) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human AIRE-1 around the phosphorylation site of S156

AIRE-1 (phospho Ser156) Polyclonal Antibody

ABP54772-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human AIRE-1 around the phosphorylation site of S156
  • Applications tips:
Description: A polyclonal antibody for detection of AIRE-1 phospho Ser156) from Human. This AIRE-1 phospho Ser156) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human AIRE-1 around the phosphorylation site of S156

AIRE-1 (phospho Ser156) Polyclonal Antibody

ABP54772-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human AIRE-1 around the phosphorylation site of S156
  • Applications tips:
Description: A polyclonal antibody for detection of AIRE-1 phospho Ser156) from Human. This AIRE-1 phospho Ser156) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human AIRE-1 around the phosphorylation site of S156

AIRE-1 (phospho Ser156) Polyclonal Antibody

ES5771-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against AIRE-1 (phospho Ser156) from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

AIRE-1 (phospho Ser156) Polyclonal Antibody

ES5771-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against AIRE-1 (phospho Ser156) from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human AIRE ELISA Kit

EHA0534 96Tests
EUR 521

Human AIRE ELISA Kit

ELA-E13302h 96 Tests
EUR 824

Goat AIRE ELISA Kit

EGTA0534 96Tests
EUR 521

Canine AIRE ELISA Kit

ECA0534 96Tests
EUR 521

Chicken AIRE ELISA Kit

ECKA0534 96Tests
EUR 521

Anserini AIRE ELISA Kit

EAA0534 96Tests
EUR 521

Bovine AIRE ELISA Kit

EBA0534 96Tests
EUR 521

AIRE ELISA KIT|Human

EF005361 96 Tests
EUR 689

AIRE Cell ELISA Kit

abx595022-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Mouse AIRE shRNA Plasmid

20-abx969093
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human AIRE shRNA Plasmid

20-abx950227
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse AIRE ELISA Kit

EMA0534 96Tests
EUR 521

Rat AIRE ELISA Kit

ERA0534 96Tests
EUR 521

Sheep AIRE ELISA Kit

ESA0534 96Tests
EUR 521

Rabbit AIRE ELISA Kit

ERTA0534 96Tests
EUR 521

Monkey AIRE ELISA Kit

EMKA0534 96Tests
EUR 521

Porcine AIRE ELISA Kit

EPA0534 96Tests
EUR 521

AIRE Recombinant Protein (Human)

RP046219 100 ug Ask for price

AIRE Recombinant Protein (Mouse)

RP115070 100 ug Ask for price

AIRE Recombinant Protein (Rat)

RP189656 100 ug Ask for price

Autoimmune Regulator Phospho-Ser156 (AIRE pS156) Antibody

20-abx012667
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Autoimmune Regulator Phospho-Ser156 (AIRE pS156) Antibody

20-abx323993
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Guinea Pig AIRE ELISA Kit

EGA0534 96Tests
EUR 521

Human Autoimmune Regulator (AIRE) Protein

20-abx652629
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Autoimmune Regulator (AIRE) Protein

20-abx652630
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Autoimmune Regulator (AIRE) Protein

20-abx652631
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Aire ORF Vector (Rat) (pORF)

ORF063220 1.0 ug DNA
EUR 506

AIRE ORF Vector (Human) (pORF)

ORF015407 1.0 ug DNA
EUR 405

Aire ORF Vector (Mouse) (pORF)

ORF038358 1.0 ug DNA
EUR 506

pECMV-Aire-m-FLAG Plasmid

PVT15034 2 ug
EUR 325

AIRE ELISA Kit (Mouse) (OKCD02354)

OKCD02354 96 Wells
EUR 857
Description: Description of target: Transcription factor playing an essential role to promote self-tolerance in the thymus by regulating the expression of a wide array of self-antigens that have the commonality of being tissue-restricted in their expression pattern in the periphery, called tissue restricted antigens (TRA) (Probable). Binds to G-doublets in an A/T-rich environment; the preferred motif is a tandem repeat of 5'-. ATTGGTTA-3' combined with a 5'-TTATTA-3' box. Binds to nucleosomes. Binds to chromatin and interacts selectively with histone H3 that is not methylated at 'Lys-4', not phosphorylated at 'Thr-3' and not methylated at 'Arg-2'. Functions as a sensor of histone H3 modifications that are important for the epigenetic regulation of gene expression. Mainly expressed by medullary thymic epithelial cells (mTECs), induces the expression of thousands of tissue-restricted proteins, which are presented on major histocompatibility complex class I (MHC-I) and MHC-II molecules to developing T-cells percolating through the thymic medulla. Also induces self-tolerance through other mechanisms such as the regulation of the mTEC differentiation program. Controls the medullary accumulation of thymic dendritic cells and the development of regulatory T-cell through the regulation of XCL1 expression. Regulates the production of CCR4 and CCR7 ligands in medullary thymic epithelial cells and alters the coordinated maturation and migration of thymocytes. In thimic B-cells, allows the presentation of licensing-dependent endogenous self-anitgen for negative selection. In secondary lymphoid organs, induces functional inactivation of CD4+ T-cells. Expressed by a distinct bone marrow-derived population, induces self-tolerance through a mechanism that does not require regulatory T-cells and is resitant to innate inflammatory stimuli.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.058 ng/mL

AIRE ELISA Kit (Human) (OKCD08086)

OKCD08086 96 Wells
EUR 975
Description: Description of target: AIRE is a transcriptional regulator that forms nuclear bodies and interacts with the transcriptional coactivator CBP. At least three splice variant mRNAs products have been described including one which results in a premature stop codon and a transcript p;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.053ng/mL

Human AIRE/ Autoimmune regulator ELISA Kit

E0100Hu 1 Kit
EUR 605

Human Autoimmune Regulator (AIRE) CLIA Kit

abx196471-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Autoimmune Regulator (AIRE) ELISA Kit

20-abx153694
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Autoimmune Regulator (AIRE) ELISA Kit

20-abx150773
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Autoimmune Regulator (AIRE) ELISA Kit

abx250784-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

AIRE Colorimetric Cell-Based ELISA Kit

EKC1020 100ul
EUR 572

Human AIRE(Autoimmune regulator) ELISA Kit

EH1501 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: O43918
  • Alias: AIRE/APECED/APS1/APSI/PGA1/APECED protein/Autoimmune polyendocrinopathy candidiasis ectodermal dystrophy protein/autoimmune regulator
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Mouse Autoimmune regulator, Aire ELISA KIT

ELI-11972m 96 Tests
EUR 865

Human Autoimmune regulator, AIRE ELISA KIT

ELI-12083h 96 Tests
EUR 824

Vibrio cholerae Sialidase-spezifische Immunantworten sind mit dem Schutz gegen Cholera verbunden 

Cholera stays a significant public well being drawback in resource-limited nations. Vaccination is a vital technique to stop cholera, however presently obtainable vaccines present solely Three to five years of safety. Understanding immune responses to cholera antigens in naturally contaminated people could elucidate which of those are key to longer-term safety seen following an infection. We not too long ago recognized Vibrio cholerae O1 sialidase, a neuraminidase that facilitates binding of cholera toxin to intestinal epithelial cells, as immunogenic following an infection in two current high-throughput screens.

Right here, we current systemic, mucosal, and reminiscence immune responses to sialidase in cholera index circumstances and evaluated whether or not systemic responses to sialidase correlated with safety utilizing a cohort of family contacts. Total, we discovered age-related variations in antisialidase immune response following cholera. Adults developed important plasma anti-sialidase IgA, IgG, and IgM responses following an infection, whereas older youngsters (≥5 years) developed each IgG and IgM responses, and youthful youngsters solely developed IgM responses.

Neither older youngsters nor youthful youngsters had an increase in IgA responses over the convalescent section of an infection (day 7/day 30). On analysis of mucosal responses and reminiscence B-cell responses to sialidase, we discovered adults developed IgA antibody-secreting cell (ASC) and reminiscence B-cell responses. Lastly, in family contacts, the presence of serum anti-sialidase IgA, IgG, and IgM antibodies at enrollment was related to a lower within the danger of subsequent an infection. These knowledge present cholera sufferers develop age-related immune responses in opposition to sialidase and recommend that immune responses that concentrate on sialidase could contribute to protecting immunity in opposition to cholera.IMPORTANCE Cholera an infection can lead to extreme dehydration which will result in demise inside a brief time frame if not handled instantly. Vaccination is a vital technique to stop the illness. Oral cholera vaccines present Three to five years of safety, with 60% protecting efficacy, whereas pure an infection supplies longer-term safety than vaccination.

Understanding the immune responses after pure an infection is vital to raised perceive immune responses to antigens that mediate longer-term safety. Sialidase is a neuraminidase that facilitates binding of cholera toxin to intestinal epithelial cells. We present right here that sufferers with cholera develop systemic, mucosal, and reminiscence B-cell immune responses to the sialidase antigen of Vibrio cholerae O1 and that plasma responses concentrating on this antigen correlate with safety.

Genexpressions- und DNA-Methylierungsanalysen legen nahe, dass zwei immunverwandte Gene prognostische Faktoren für Darmkrebs sind 

Background: Colorectal most cancers (CRC) is the second most prevalent most cancers, because it accounts for roughly 10% of all yearly recognized cancers. Research have indicated that DNA methylation is concerned in most cancers genesis. The aim of this examine was to analyze the relationships amongst DNA methylation, gene expression and the tumor-immune microenvironment of CRC, and eventually, to determine potential key genes associated to immune cell infiltration in CRC.

Strategies: Within the current examine, we used the ChAMP and DESeq2 packages, correlation analyses, and Cox regression analyses to determine immune-related differentially expressed genes (IR-DEGs) that had been correlated with aberrant methylation and to assemble a danger evaluation mannequin.

Outcomes: Lastly, we discovered that HSPA1A expression and CCRL2 expression had been positively and negatively related to the danger rating of CRC, respectively. Sufferers within the high-risk group had been extra positively correlated with some varieties of tumor-infiltrating immune cells, whereas they had been negatively correlated with different tumor-infiltrating immune cells. After the sufferers had been regrouped in accordance with the median danger rating, we might extra successfully distinguish them based mostly on survival final result, clinicopathological traits, particular tumor-immune infiltration standing and extremely expressed immune-related biomarkers.

Conclusion: This examine advised that the danger evaluation mannequin constructed by pairing immune-related differentially expressed genes correlated with aberrant DNA methylation might predict the result of CRC sufferers and would possibly assist to determine these sufferers who may benefit from antitumor immunotherapy.

Assoziation von Polymorphismen in Genen, die an der Schmelzbildung, der Geschmackspräferenz und der Immunantwort beteiligt sind, mit Karies im frühen Kindesalter bei saudischen Vorschulkindern 

Dental caries is primarily elicited by modifiable components reminiscent of insufficient oral hygiene, poor dietary practices and poor fluoride publicity. Nonetheless, there’s a rising physique of proof suggesting the profound affect of genetic components in dental caries susceptibility. The current examine aimed to guage the affiliation between single nucleotide polymorphisms (SNPs) in ENAM (rs12640848), MMP20 (rs1784418), TAS2R38 (rs713598), and LTF (rs4547741) genes and early childhood caries (ECC) in Saudi preschool youngsters.

This case-control examine enrolled 360 Saudi preschool youngsters (262 with ECC and 98 caries-free). Information on environmental components had been collected by a questionnaire. Nonetheless, caries expertise and oral hygiene knowledge had been obtained throughout scientific examination. Buccal swab samples had been collected for DNA extraction and SNPs had been genotyped utilizing PCR and DNA sequencing. Youngsters with ECC had been in comparison with caries free youngsters (management), then they had been categorized into two classes based mostly on ECC severity as follows; non-severe ECC (NS-ECC), and severe-ECC (S-ECC). Affiliation between the SNPs, ECC, NS-ECC, and S-ECC was reported as an odds ratio (OR) with a 95% confidence interval (CI). The vast majority of the youngsters (72.8%) exhibited ECC (31.7% NS-ECC and 41.1% S-ECC) with imply dmft of 4.20 ± 4.05. Multivariate analyses of environmental components confirmed that nocturnal feeding was a danger issue for ECC (P = 0.008). Poor oral hygiene was additionally a danger issue for each NS-ECC and S-ECC (ECC: P < 0.0001, NS-ECC: P = 0.032 and S-ECC: P < 0.0001).

Univariate evaluation confirmed that the AG genotype of rs1784418 of MMP20 gene was protecting in opposition to ECC (OR = 0.532; 95% CI = 0.316-0.897, P = 0.018) and in opposition to NS-ECC (OR = 0.436; 95% CI = 0.238-0.798, P = 0.007). When environmental danger components for ECC had been included as covariates throughout multivariate evaluation, AG variant in rs1784418 of MMP20 gene remained much less frequent in NS-ECC circumstances in comparison with controls with borderline significance (OR = 0.542; 95% CI = 0.285-1.033, P = 0.063). Our findings concluded that MMP20 rs1784418 SNP could be related to safety in opposition to ECC in Saudi preschool youngsters.

Human T-Cell, Immune Regulator 1 (TCIRG1) ELISA Kit

DLR-TCIRG1-Hu-96T 96T
EUR 725
  • Should the Human T-Cell, Immune Regulator 1 (TCIRG1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human T-Cell, Immune Regulator 1 (TCIRG1) in samples from serum or other biological fluids.

Human T-Cell, Immune Regulator 1 (TCIRG1) ELISA Kit

RD-TCIRG1-Hu-48Tests 48 Tests
EUR 563

Human T-Cell, Immune Regulator 1 (TCIRG1) ELISA Kit

RD-TCIRG1-Hu-96Tests 96 Tests
EUR 783

Human T-Cell, Immune Regulator 1 (TCIRG1) ELISA Kit

RDR-TCIRG1-Hu-48Tests 48 Tests
EUR 589

Human T-Cell, Immune Regulator 1 (TCIRG1) ELISA Kit

RDR-TCIRG1-Hu-96Tests 96 Tests
EUR 820

TCIRG1 Antibody

25518-100ul 100ul
EUR 390

TCIRG1 antibody

70R-20741 50 ul
EUR 435
Description: Rabbit polyclonal TCIRG1 antibody

TCIRG1 Antibody

1-CSB-PA615690LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TCIRG1. Recognizes TCIRG1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

TCIRG1 Antibody

1-CSB-PA023312GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TCIRG1. Recognizes TCIRG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

TCIRG1 siRNA

20-abx936356
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-TCIRG1

YF-PA16872 50 ug
EUR 363
Description: Mouse polyclonal to TCIRG1

anti-TCIRG1

YF-PA25542 50 ul
EUR 334
Description: Mouse polyclonal to TCIRG1

HEK-293T Telomerase Over-Expressing Cell Pellet

abx069991-1Pellet 1 Pellet
EUR 398
  • Shipped within 1-3 working days.

TCIRG1 Polyclonal Antibody

28940-100ul 100ul
EUR 252

TCIRG1 Polyclonal Antibody

28940-50ul 50ul
EUR 187

TCIRG1 Rabbit pAb

A15382-100ul 100 ul
EUR 308

TCIRG1 Rabbit pAb

A15382-200ul 200 ul
EUR 459

TCIRG1 Rabbit pAb

A15382-20ul 20 ul
EUR 183

TCIRG1 Rabbit pAb

A15382-50ul 50 ul
EUR 223

Polyclonal TCIRG1 Antibody

APR10389G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TCIRG1 . This antibody is tested and proven to work in the following applications:

TCIRG1 cloning plasmid

CSB-CL615690HU-10ug 10ug
EUR 808
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2493
  • Sequence: atgggctccatgttccggagcgaggaggtggccctggtccagctctttctgcccacagcggctgcctacacctgcgtgagtcggctgggcgagctgggcctcgtggagttcagagacctcaacgcctcggtgagcgccttccagagacgctttgtggttgatgttcggcgctgtg
  • Show more
Description: A cloning plasmid for the TCIRG1 gene.

anti- TCIRG1 antibody

FNab08558 100µg
EUR 548.75
  • Immunogen: T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3
  • Uniprot ID: Q13488
  • Gene ID: 10312
  • Research Area: Signal Transduction
Description: Antibody raised against TCIRG1

Anti-TCIRG1 antibody

PAab08558 100 ug
EUR 386

pCMV-SPORT6-TCIRG1

PVT13940 2 ug
EUR 391

Anti-TCIRG1 antibody

STJ117577 100 µl
EUR 277
Description: This gene encodes a subunit of a large protein complex known as a vacuolar H+-ATPase (V-ATPase). The protein complex acts as a pump to move protons across the membrane. This movement of protons helps regulate the pH of cells and their surrounding environment. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, and receptor-mediated endocytosis. V-ATPase is comprised of a cytosolic V1 domain and a transmembrane V0 domain. Alternative splicing results in multiple transcript variants. Mutations in this gene are associated with infantile malignant osteopetrosis.

Anti-TCIRG1 (6H3)

YF-MA17246 50 ug
EUR 363
Description: Mouse monoclonal to TCIRG1

Anti-TCIRG1 (6H3)

YF-MA17247 200 ul
EUR 363
Description: Mouse monoclonal to TCIRG1

Anti-TCIRG1 (7H20)

YF-MA17248 50 ug
EUR 363
Description: Mouse monoclonal to TCIRG1

Anti-TCIRG1 (7H20)

YF-MA20492 200 ul
EUR 363
Description: Mouse monoclonal to TCIRG1

Chymase reagent

30C-CP1129 5 units
EUR 2185
Description: Purified native Human Chymase reagent

Traut's Reagent

2330-1000
EUR 349

Traut's Reagent

2330-500
EUR 207

MTS Reagent

2808-1000
EUR 990

MTS Reagent

2808-250
EUR 365

MTT Reagent

2809-1G
EUR 180

MTT Reagent

2809-5G
EUR 544

BOP reagent

5-02141 25g Ask for price

BOP reagent

5-02142 100g Ask for price

Bluing Reagent

BRT030 30 ml
EUR 60

Bluing Reagent

BRT125 125 ml
EUR 63

Bluing Reagent

BRT3800 1 Gal.
EUR 184

Bluing Reagent

BRT500 500 ml
EUR 76

Bluing Reagent

BRT999 1000 ml
EUR 88

BOP reagent

A7015-100000 100 g
EUR 200
Description: A peptide coupling reagent. Can be used in the preparation of phenyl esters of amino acids which have been shown to be valuable as blocked derivatives of amino acids in the field of peptide synthesis.

BOP reagent

A7015-25000 25 g
EUR 113
Description: A peptide coupling reagent. Can be used in the preparation of phenyl esters of amino acids which have been shown to be valuable as blocked derivatives of amino acids in the field of peptide synthesis.

Beaucage reagent

HY-100951 10mM/1mL
EUR 126

Bradford reagent

BDE641 100ml
EUR 61.01
  • Product category: Biochemicals/Biology Reagents/Protein Related

TCIRG1 Antibody, HRP conjugated

1-CSB-PA615690LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TCIRG1. Recognizes TCIRG1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TCIRG1 Antibody, FITC conjugated

1-CSB-PA615690LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TCIRG1. Recognizes TCIRG1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TCIRG1 Antibody, Biotin conjugated

1-CSB-PA615690LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TCIRG1. Recognizes TCIRG1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TCIRG1 ELISA KIT|Human

EF003500 96 Tests
EUR 689

Human TCIRG1 ELISA KIT

ELI-51415h 96 Tests
EUR 824

TCIRG1 Polyclonal Conjugated Antibody

C28940 100ul
EUR 397

Human TCIRG1 shRNA Plasmid

20-abx956986
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Arabidopsis Thaliana Lysate

30R-AA023 150 ug
EUR 156
Description: Arabidopsis Thaliana Plant Lysate

CMV Cell Lysate

35-1867 1 mg
EUR 1835
Description: CMV enriched cell lysate

HSV1 Cell Lysate

35-1872 1 ml
EUR 394
Description: HSV1 enriched cell lysate

HSV2 Cell Lysate

35-1873 1 ml
EUR 394
Description: HSV2 enriched cell lysate

JM109-lysate Antibody

abx234439-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

BL21-lysate Antibody

abx230905-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

DH5a-lysate Antibody

abx232362-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Green Algae Lysate

PABL-1306 50 ug
EUR 164

BSA (Reagent Grade)

30-AB79 1 kg
EUR 1552
Description: Reagent Grade Bovine Serum Albumin (99% pure)

BSA (Reagent Grade)

30-AB81 200 grams
EUR 476
Description: Reagent Grade Sulphydryl Blocked BSA (99% pure)

Griess Reagent Kit

30100 1KIT
EUR 149
Description: Minimum order quantity: 1 unit of 1KIT

BODIPY-Acetylene Reagent

2594-1
EUR 207

BODIPY-Acetylene Reagent

2594-5
EUR 675

Biotin reagent (HRP)

65C-CE0202 5 mg
EUR 244
Description: HRP conjugated biotin labelling reagent

Convoy? Transfection Reagent

1110-1ml
EUR 341

Bradford Dye Reagent

0209R 100 ml
EUR 131

HAMA blocking reagent

85R-1001 1 gram
EUR 1974
Description: HAMA Blocking Reagent for use in immunoassays such as ELISA

HAMA blocking reagent

85R-1001P 1 gram
EUR 2190
Description: HAMA Blocking Reagent for use in immunoassays such as ELISA

HAMA blocking reagent

85R-1003 1 gram
EUR 1974
Description: HAMA Blocking Reagent for use in immunoassays such as Rapid Tests

HAMA blocking reagent

85R-1014 50 mg
EUR 192
Description: HAMA blocking reagent for use in assays specific for clinical false positive samples

HAMA blocking reagent

85R-1025 50 mg
EUR 192
Description: HAMA blocking reagent for use in immunoassays

HAMA blocking reagent

85R-1026 50 mg
EUR 192
Description: HAMA blocking reagent for use in immunoassays

Girard's reagent T

20-abx184099
  • EUR 203.00
  • EUR 314.00
  • 100 g
  • 500 g
  • Shipped within 1-2 weeks.

EL Transfection Reagent

20-abx098880
  • EUR 384.00
  • EUR 537.00
  • 0.75 ml
  • 1.5 ml
  • Shipped within 5-10 working days.

Mycoplasma Prevention Reagent

20-abx098886
  • EUR 425.00
  • EUR 509.00
  • 1 ml
  • 5 ml
  • Shipped within 5-10 working days.

Alcohol, Reagent (70%)

EAS500 500 ml
EUR 79

Alcohol, Reagent (70%)

EAS999 1000 ml
EUR 101

BCA Reagent, 16ML

C144-16ML 16ML
EUR 163

Biolipidure-1002-Reagent

Biolipidure-1002-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1002-Reagent is a synthetic amphoteric polymer that can be substituted for BSA in tubidimetric immunoassays. Biolipidure-1002 is an excellent blocker and also enhances assay sensitivity. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1002-Reagent

Biolipidure-1002-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1002-Reagent is a synthetic amphoteric polymer that can be substituted for BSA in tubidimetric immunoassays. Biolipidure-1002 is an excellent blocker and also enhances assay sensitivity. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-103-Reagent

Biolipidure-103-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-103-Reagent is a synthetic amphoteric polymer that can be substituted for BSA. It has been shown to enhance signals in rapid tests, western blots, and other similar immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-103-Reagent

Biolipidure-103-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-103-Reagent is a synthetic amphoteric polymer that can be substituted for BSA. It has been shown to enhance signals in rapid tests, western blots, and other similar immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1201-Reagent

Biolipidure-1201-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1201 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1201-Reagent

Biolipidure-1201-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1201 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1301-Reagent

Biolipidure-1301-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1301 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1301-Reagent

Biolipidure-1301-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1301 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-203-Reagent

Biolipidure-203-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-203 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-203 has been shown to enhance signal strength by improving signal-to-noise in ELISAs, EIAs, and related immunoassays. It also functions as an effective blocker and stabilizer in these assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-203-Reagent

Biolipidure-203-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-203 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-203 has been shown to enhance signal strength by improving signal-to-noise in ELISAs, EIAs, and related immunoassays. It also functions as an effective blocker and stabilizer in these assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-206-Reagent

Biolipidure-206-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-206 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-206 enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-206-Reagent

Biolipidure-206-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-206 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-206 enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-405-Reagent

Biolipidure-405-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-405 Reagent is a synthetic anionic polymer that can be used to enhance immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-405-Reagent

Biolipidure-405-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-405 Reagent is a synthetic anionic polymer that can be used to enhance immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-502-Reagent

Biolipidure-502-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-502 Reagent is a synthetic cationic polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-502-Reagent

Biolipidure-502-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-502 Reagent is a synthetic cationic polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-702-Reagent

Biolipidure-702-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-702 Reagent is a synthetic amphoteric polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-702-Reagent

Biolipidure-702-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-702 Reagent is a synthetic amphoteric polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-802-Reagent

Biolipidure-802-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-802 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-802 generally enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, Rapid-test, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-802-Reagent

Biolipidure-802-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-802 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-802 generally enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, Rapid-test, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

FcR blocking Reagent

20-abx290024
  • EUR 377.00
  • EUR 516.00
  • 200 tests
  • 400 tests
  • Shipped within 2-3 weeks.

Detection Reagent A

abx296004-120ul 120 ul
EUR 321
  • Shipped within 5-10 working days.

Mycoplasma Prevention Reagent

20-abx298005
  • EUR 203.00
  • EUR 286.00
  • 1 ml
  • 5 ml
  • Shipped within 5-10 working days.

PhosphoBlocker Blocking Reagent

AKR-103 1L
EUR 328
Description: Most commercially available Western blot blockers, such as dry milk or serum, are sufficient to block unreactive sites on the membrane. However, they are not designed to preserve phosphoprotein antigens during blotting. Our PhosphoBLOCKER Blocking Reagent provides superior blocking by maximizing signal-to-noise ratio. The PhosphoBLOCKER reagent particluarly excels with very low levels of endogenous phopsphoproteins.

PhosphoBlocker Blocking Reagent

AKR-104 4L
EUR 711
Description: Most commercially available Western blot blockers, such as dry milk or serum, are sufficient to block unreactive sites on the membrane. However, they are not designed to preserve phosphoprotein antigens during blotting. Our PhosphoBLOCKER Blocking Reagent provides superior blocking by maximizing signal-to-noise ratio. The PhosphoBLOCKER reagent particluarly excels with very low levels of endogenous phopsphoproteins.

Tri-RNA Reagent

FATRR-001 100ml
EUR 236

Tri-RNA Reagent

FATRR-002 50ml
EUR 176

Tri-RNA Reagent

FATRR-003 450ml
EUR 645

LP4K Transfection Reagent

LP4K 1.0 ml / vial
EUR 304
Description: Lipid based transfection reagent for large plasmid and multiple plasmid transfection in both adhesive and suspenstion cell types.

PureFection Transfection Reagent

LV750A-1 1 ml
EUR 359
  • Category: Lentiviral Technology

HighGene transfection reagent

RM09014 1000μl
EUR 270

TissueDigest Reagent, 20X

T101 10ml
EUR 210

ExFect2000 Transfection Reagent

T202-01 0.5 ml
EUR 227

ExFect2000 Transfection Reagent

T202-02 1 ml
EUR 316

ExFect2000 Transfection Reagent

T202-03 5 ml
EUR 1052

Dissociation Reagent, 1ML

X017-1ML 1ML
EUR 109

Dissociation Reagent, 25ML

X017-25ML 25ML
EUR 258

Dissociation Reagent, 5ML

X017-5ML 5ML
EUR 122

Dissociation Reagent, 1ML

X058-1ML 1ML
EUR 73

Dissociation Reagent, 5ML

X058-5ML 5ML
EUR 109

DTT (Cleland's reagent)

DB0058 5g
EUR 84.8
  • Product category: Electrophoresis Related/Reducing Agents

DTNB (Ellman's Reagent)

DB0113 5g
EUR 97.85
  • Product category: Biochemicals/Indicators/Stains/Peptide/Protein Related

Ethyl acetate Reagent

EC4600 1L
EUR 79
  • Product category: Biochemicals/Solvents

n-Heptane Reagent

HC5400 1L
EUR 79
  • Product category: Biochemicals/Solvents

Tcirg1 ORF Vector (Rat) (pORF)

ORF077544 1.0 ug DNA
EUR 506

TCIRG1 ORF Vector (Human) (pORF)

ORF010389 1.0 ug DNA
EUR 95

Tcirg1 ORF Vector (Mouse) (pORF)

ORF059299 1.0 ug DNA
EUR 506

Tcirg1 ORF Vector (Mouse) (pORF)

ORF059300 1.0 ug DNA
EUR 506

Tcirg1 ORF Vector (Mouse) (pORF)

ORF059301 1.0 ug DNA
EUR 506

TCIRG1 ELISA Kit (Human) (OKCD02071)

OKCD02071 96 Wells
EUR 909
Description: Description of target: Part of the proton channel of V-ATPases. Seems to be directly involved in T-cell activation.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 6.0 pg/mL

TCIRG1 ELISA Kit (Human) (OKCA02155)

OKCA02155 96 Wells
EUR 833
Description: Description of target: Part of the proton channel of V-ATPases.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 2.34 pg/mL

Human Brain Tissue Lysate

30R-AB017 150 ug
EUR 273
Description: Fresh tissue lysate isolated from human brain

Chicken Liver Tissue Lysate

30R-AC011 150 ug
EUR 192
Description: Freshly prepared tissue lysate isolated from liver of normal chicken

Human Cerebellum Tissue Lysate

30R-AC058 150 ug
EUR 290
Description: Freshly prepared tissue lysate isolated from cerebellum of human brain

Human Hippocampus Tissue Lysate

30R-AH 150 ug
EUR 273
Description: Isolated Human Hippocampus Tissue Lysate

Human Heart Tissue Lysate

30R-AH049 150 ug
EUR 534
Description: Fresh tissue lysate isolated from human heart

Jurkat cell Lysate (untreated)

2401-100
EUR 185

Human Kidney Tissue Lysate

30R-AK003 150 ug
EUR 219
Description: Fresh tissue lysate isolated from human kidney

Rabbit Liver Tissue Lysate

30R-AL003 150 ug
EUR 252
Description: Fresh tissue lysate prepared from rabbit liver

Human Lung Tissue Lysate

30R-AL006 150 ug
EUR 219
Description: Fresh tissue lysate isolated from human lung

Human Midbrain Tissue Lysate

30R-AM011 150 ug
EUR 257
Description: Fresh tissue lysate isolated from the midbrain of human brain

Human Pancreas Tissue Lysate

30R-AP030 150 ug
EUR 219
Description: Fresh tissue lysate isolated from human pancreas

Human Prostate Tissue Lysate

30R-AP031 150 ug
EUR 219
Description: Fresh tissue lysate prepared from normal human prostate

Human Pons Tissue Lysate

30R-AP033 150 ug
EUR 235
Description: Fresh tissue lysate isolated from the pons of human brain

Human Posterior Cortex Lysate

30R-AP034 150 ug
EUR 235
Description: Fresh tissue lysate isolated from the posterior cortex of human brain

Rat Retina Tissue Lysate

30R-AR005 150 ug
EUR 267
Description: Fresh tissue lysate prepared from the retina of rat eye

Human Striatum Tissue Lysate

30R-AS030 150 ug
EUR 327
Description: Fresh tissue lysate isolated from the striatum of human brain

Human Stomach Tissue Lysate

30R-AS039 150 ug
EUR 219
Description: Fresh tissue lysate isolated from human stomach

Human Thalamus Tissue Lysate

30R-AT053 150 ug
EUR 235
Description: Fresh tissue lysate isolated from the thalamus of human brain

JNK Activated Cell Lysate

7032-1
EUR 316

Akt Activated Cell Lysate

7036-1
EUR 316

BL21(DE3)-lysate Antibody

abx230903-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

BL21(plysS) -lysate Antibody

abx230904-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Human Lung Tumor lysate

HTL-1321 1 mg
EUR 773

Human Brain Tumor lysate

HTL-1322 1 mg
EUR 773

Human Breast Tumor lysate

HTL-1323 1 mg
EUR 773

Human Kidney Tumor lysate

HTL-1324 1 mg
EUR 773

Human Bladder Tumor lysate

HTL-1325 1 mg
EUR 773

Human Cervix Tumor lysate

HTL-1326 100ug
EUR 286

Human Duodenum Tumor lysate

HTL-1328 1 mg
EUR 895

Human Esophagus tumor lysate

HTL-1329 1 mg
EUR 773

Human Liver Tumor lysate

HTL-1330 1 mg
EUR 773

Human Lymphoma Tumor lysate

HTL-1331 1 mg
EUR 773

Human Ovary Tumor lysate

HTL-1333 1 mg
EUR 773

Human Pancreas Tumor lysate

HTL-1334 1 mg
EUR 773

Human Prostate Tumor lysate

HTL-1335 1 mg
EUR 773

Human Rectum Tumor lysate

HTL-1336 1 mg
EUR 773

Human Skin Tumor lysate

HTL-1337 1 mg
EUR 773

Human Spleen Tumor lysate

HTL-1339 1 mg
EUR 773

Human Stomach Tumor lysate

HTL-1340 1 mg
EUR 773

Human Testis Tumor lysate

HTL-1381 1 mg
EUR 773

Human Thymoma Tumor lysate

HTL-1382 1 mg
EUR 773

Human Thyroid Tumor lysate

HTL-1383 1 mg
EUR 773

Leave a Reply

Your email address will not be published. Required fields are marked *